Study Guides

Calculations Review Answers Equations & Formulas Sheet

Plants: Beyond Photosynthesis

Homeostasis & Systems Part I ----- Part II ----- Part III ----- Part IV
Animal/Human System Summaries

Origins and Diversity of Life Continued Origins of Prokaryotes (Domains Bacteria and Archaea) and metabolic diversity; Origins of Eukaryotes - Protists and Fungi.
Origins and Diversity of Life

An alien invasion! They hit us hard and fast - leaving before we can see them. Our food is being gobbled up faster than we can grow it! But alas, we have obtained a sample of their vital fluids and found DNA! DNA? Yes, DNA. What on Earth might help us understand what we are dealing with? We analyzed the DNA and found the gene sequence below:
ATGGGGGAGGCTCTGGATCACGTCTTCATTCTTGTAGGGCTGCTGGTGTGCCTGGCGTTTCTGGTGAAGT
GTGTGAGATTCTCCAAATGTGTTCTTCGGAGCTTCAGGAAAACTGTGCCCCCATCTTTCTTGCCATCCAT
GGGCCAGTGGGCAGTTATCACTGGAGCAGGTGATGGGATCGGAAAAGCGTATGCATTTGAGCTAGCAAGA
CGAGGACTCAATGTTGTACTCATCAGCCGGACGCTGGAAAAACTCCAGACCATTGCCACTGAGATCGCAG
GTTCTACTGGGAGAAGTGTGAAGATTATACAAGCAGATTTTACCAAAGATGACATCTATGAATATATTAA
AGAAAACCTTAAAGGCTTAGAAATTGGAGTCTTAGTCAACAATGTTGGAATGCTTGCAAGCCGTGTCCCG
AGCCATTTCCTTACCACACCGGACAGCATCCAGAGCCTCATCCACTGTAACATCACCTCGGTAATCAAGA
TGACACAGGTGGTCCTGAGACACATGGAATCAAGGAGGAAAGGTCTCATCTTGAACATTTCTTCAGGGGC
ATCCCTCCGTCCTTGGCCTCTGTTCTCTCTGTACTCAGCTTCCAAGGCTTTCGTGCGCATGTTTTCCAAG
GCGCTGCAAATGGAATATAGAGAGAAAGGGATCATTATCCAGGTTCTCACCCCGTTTGCTGTTTCTACTG
CCATGACAAATTATCGAGACACCAGCATGATGACCAAAAGTGCTGATGGATTTGTGAAAGAATCACTGAA
TTACGTCATGGCAGGAGACGAAGCCTGTGGTTCCCTTGCCCATGAAATCTTGGGACAATTTCTGAACCTG
ATCCCATCTTGGATCTTCTACAGCCAGGCCTTCCAGTCTCTCCTCCTGACATGCCAGTCAGATGACAGAA
CACAGAACCGCAAAGTCAACTAA
Please. Oh, the humanity... We need to know what these invaders look like - so we can begin to wipe these invaders from the face of the Earth and STOP THE MADNESS!


Evolution Because evolution is discussed in multiple chapters of your textbook, the study guide will be especially helpful in organizing your study and in understanding the essential concepts.

Microbial Genetics, Gene Regulation, and DNA Technology

Sexual Reproduction & Heredity

From Genes to Proteins
Transcription Video

The Cell Cycle, DNA, and DNA Replication
Cell Communication Cel Cycle Regulation and Cancer 19.14.png
Click to access the figure above and use it to connect cell communication to regulation of the cell cycle and also to compare normal versus cancer cells - just add a discussion of checkpoints, cyclins, cdks, and MPFs to complete the story!


Cellular Energetics: Photosynthesis and Cellular Respiration

Cell Communication

Cells and Membranes

Energy and Enzymes

The Chemistry of Life

Biological Interactions: An Ecological Context